| Home | E-Submission | Sitemap | Contact Us |  
Environ Eng Res > Volume 30(4); 2025 > Article
Gao, Wu, Qu, Zhao, Du, Zheng, Li, and Xie: Establishment of diesel oil degrading bacteria compounding system and its migration performance in aquifers

Abstract

Bioremediation is a cost-effective and eco-friendly method to remove diesel oil contaminant from the environment. In this study, six diesel oil-degrading bacteria were isolated and identified from diesel oil-polluted groundwater. The compound bacterial agent was constructed based on antagonistic tests. The target compound bacterial agent NK4/ B29/ C1A showed the highest potential for remediating of 1 g/L diesel pollution groundwater, with a degradation rate of 85.91%. The degradation products had a lower relative content of low molecular semi-volatile organic compounds (C10- C16) compared with their predecessors, presenting a decrease from 79.18% to 0. The results of one-dimensional sand column experiment showed that the injection rate of microbial agents was positively correlated with particle size, while the migration has a better performance under lower ion strength. The increase in ionic strength altered the particle size and electronegativity of the compound bacteria, leading to compression of the double layer and making migration in the aquifer more poor. Additionally, following the injection of a uniformly mixed microbial agent into the aquifer, the phenomenon of bacterial agent separation occurred. The migration ability of Pseudomonas aeruginosa was stronger than that of Alcaligenes fischeri and Pseudomonas guguanensis in the aquifer.

Graphical Abstract

/upload/thumbnails/eer-2024-335f8.gif

Introduction

The large-scale exploration and utilization of petroleum worldwide have led to extensive soil and groundwater pollution [1]. Components of diesel oil are the primary contributors to the total petroleum hydrocarbons (TPH) found in groundwater [2]. The diesel pollution in groundwater has threatened the health of residents nearby due to its high concentration and toxicity [3]. Diesel-contaminated groundwater has been reported to have a significant carcinogenic effect and bring about an increased incidence of skin diseases [4], and it is of great importance to remove diesel oil from the environment. At present, the remediation technologies of diesel polluted groundwater include extraction treatment, chemical oxidation, air aeration, etc [5]. Despite their effectiveness in treating diesel oil-polluted groundwater, these technologies are still exposed to certain limitations. For example, through the preparation of green synthetic materials, combined with electrochemical or oxidizing catalysts for the repair of hydrocarbons, but this way is currently not engineering applications, mainly because of the high cost [6, 7]. Compared to the above technologies, microbial remediation technology is considered the most promising diesel oil remediation technology due to its economy, lower energy consumption, and no secondary pollution [8, 9].
Both biotransformation and biodegradation processes are involved in the biodegradation process of TPH [10]. Within microorganisms, TPH undergoes a series of biological enzyme reactions, including catalytic oxidation by oxygenase and catalase, resulting in the formation of intermediate products such as acetic acid and pyruvate. These intermediates initiate various metabolic pathways, including the tricarboxylic acid cycle and the glyoxylate cycle, ultimately undergoing oxidation to carbon dioxide and water [11]. Up to now, over 200 types of microorganisms capable of degrading TPH have been identified and cultivated, spanning more than 100 genera. Among these, bacteria comprise over 40 genera, including Rhodococcus, Bacillus, Pseudomonas, alkanobacteria, Arthrobacter, Brevibacterium and Acinetobacter [12]. Most of previous studies on microbial degradation of TPH focused on obtaining efficient TPH-degrading strains from the environment and delving into their degradation characteristics [13, 14]. Considering the complex composition of TPH, synergies between microorganisms emerged [15]. In recent years, the research focus has been mainly shifted to TPH microbial remediation on the construction of compound bacteria. Due to the complex composition of TPH, a single microorganism may not effectively degrade all its components, resulting in the partial degradation of TPH [16, 17]. The participation of various microorganisms together generally results in relatively high treatment efficiency. Hence, the joint participation of a variety of microorganisms is promising for high-efficient degradation of TPH pollutants. For example, Ghazali et al [18] studied the degradation of hydrocarbons by two compound bacteria, and found that the compound bacteria community composed of six different strains had a better effect on the removal of long-chain alkanes. Rambeloarisoa et al [19] confirmed that the compound agent of eight strains had a better degradation effect on crude oil than the compound agent of five strains.
However, for in-situ groundwater pollution remediation, the amplified microbial bacteria should be necessarily injected into the aquifer to form the microbial in-situ reactive zone [20, 21]. These microbial bacteria exhibit different migration properties under the influence of their own properties and groundwater chemical conditions. Most of the previous studies utilized single bacterial strains to clarify their migration characteristics in aquifers [22]. For example, Li et al [23] conducted sand column experiments to clarify the migration and retention rules of polycyclic aromatic hydrocarbon (PAH) degrading bacteria FA1 in aquifers. Qu et al [24] studied the migration mechanism of aniline-degrading bacterium Pseudomonas migulae AN-1 in aquifers and the methods to enhance its migration in aquifers. Nevertheless, the diesel oil degrading bacteria with high efficiency were mostly compound bacteria [25], while the migration abilities of compound bacteria remain undefined. Therefore, it is worth investigating whether such mixed bacteria will exhibit varying migration abilities in the aquifer due to differences in their nature, which might potentially influence the degradation efficacy of diesel oils. However, studies on the migration and retention characteristics of mixed bacteria in aquifers have been rarely reported.
This study constructed the diesel oil degrading compound bacteria and studied their migration and retention characteristics in one-dimensional saturated sand columns, which may shed light on the migration properties of compound bacteria. The specific objectives were as follows: 1) Taking diesel oil as the target pollutant, the diesel oil degrading bacteria were screened from the aquifer medium, and the compound bacteria with efficient TPH degrading ability was constructed; 2) The effects of temperature, pH, initial concentration of diesel oils and inoculum amount on TPH degradation were determined; 3) The influence of aquifer medium particle size, injection velocity and ion strength on the migration performance was analyzed to reveal the migration mechanism of the compound bacteria in aquifer; and 4) The retention and distribution characteristics of compound bacteria in aquifers were identified.

Materials and Methods

2.1. Chemicals

Chemicals, including Hydrochloric acid (AR, HCl), Sodium hydroxide (AR, NaOH), it is mainly used to adjust the pH of the reaction system; Glycerol (AR, C3H8O3), used for the preservation of microbial bacteria; Tetrachloroethylene (AR, CCl4), used to extract petroleum hydrocarbons from groundwater; Sodium sulfate (AR, Na2SO4), used to remove moisture from the extract; Calcium chloride (AR, CaCl2), it is used to simulate background ions in groundwater. The 0# diesel was purchased from CNPC gas stations with a density of 0.8 kg/L, serving as the degradation substrate. The sterile-filtered diesel was added to the inorganic salt medium at the concentration of 0.5% to obtain the enrichment culture. The isolated strains were purified and activated in LB agar plate medium (BR), then cultured in LB liquid medium (BR). The Gram staining solution Kit, purchased from China National Pharmaceutical Group Limited, were used in the Gram straining experiment. Quartz sand of different sizes were used to establish one-dimensional soil columns in the migration ability experiment. Quartz sand (Particle size: 0.5–1 mm, 0.25–0.5 mm, 0.125–0.25 mm) was purchased from Hong Andan Building Materials Co., Ltd (Beijing, China).

2.2. Screening and Identification of Bacterial Strains

The experimental bacterial strains were screened from the contaminated soil after a diesel oil pipeline leak in Xinjiang, China. Specifically, 5 g contaminated soil samples were added to the enrichment culture and cultivated at 30 °C and 150 rpm for 7 d. Then, 1 mL of the culture was transferred to a fresh enrichment medium and cultivated as above to obtain a sub-culture. The cultivation from the third sub-culture medium were diluted and spread on solid plate of enrichment medium. The plates were cultivated at 30 °C and every colony was screened to obtain pure strains.
The isolated bacterial strains were identified using physiological and biochemical methods (morphography and standard protocol of Gram staining) and gene sequencing. PCR reaction system components included 10×Ex Taq buffer, 2 μL; 5 U/μL Ex Taq, 0.2 μL; 2.5 mmol/L dNTP Mix, 1.6 μL; 5 μmol/L Primer1, 1 μL; 5 μmol/L Primer2, 1 μL; DNA, 0.5 μL; and ddH2O, 13.7 μL. The primer sequences used were 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT). The PCR amplification was performed as follows: initial denaturation at 95 °C for 5 min, 25 cycles of denaturing at 95 °C for 30 s, annealing at 56 °C for 30 s, followed by extension at 72 °C for 90 s. The final extension was carried out at 72 °C for 10 min.. The PCR products were then sent for Sanger sequencing at Shanghai Majorbio Technology Co., Ltd., and the assembled sequences were analyzed by BLAST against the GenBank database. There were six strains identified.

2.3. Growth Curve and Counting Method of Diesel Oil Degrading Bacteria

The growth curve of diesel oil degrading bacteria was measured using the turbidity method. Specifically, the absorbance of bacterial liquid at 600 nm wavelength (The colorimetric dish is quartz colorimetric dish with seam width of 2 mm.) of ultraviolet spectrophotometer was measured using a ultraviolet spectrophotometer, thereby indirectly reflecting the growth amount of degrading bacteria.
The relationship between the number of microorganisms and the absorbance of OD 600 was obtained using the method of plate counting. First, 100 μL bacterial solution was added into a 2 mL centrifuge tube containing 900 μL sterile water, mixed well, diluted according to the gradient of 10−1, 10−2, 10−3, 10−4, 10−5, 10−6, 10−7, 10−8 and 10−9, and coated on a plate. Subsequently, the absorbance of the bacterial solution with different dilution times was measured using a OD 600 ultraviolet spectrophotometer. After measuring the absorbance, the bacterial solution with different dilution times was evenly coated on LB nutrient agar plate medium with a coating rod, and cultured in a high-precision combined shock incubator at 30 °C for 48 h. After culture, the relationship between OD 600 and biomass was clarified through counting statistics, and the results are shown in Fig. S1.

2.4. Antagonism Experiment

The six identified strains were inoculated onto LB plate medium in an adjacent manner and cultured in incubator at 30 °C for 7 d. The antagonistic effect between strains was judged according to whether the colonies grew together, and the combination of mutually antagonistic strains was removed. Then the three-bacterium combination scheme was adopted, and there were eight groups of compound bacteria obtained.

2.5. Diesel Oil Degradation Abilities of Compound Bacteria

By comparing the degradation effect of each single bacteria and the eight combinations, the bacteria were inoculated in oily waste-water with diesel oil concentration of 1 g/L at room temperature. The concentration of diesel oil in water was determined by referring to ‘Determination of Petroleum and Animal and Vegetable Oils in Water by Infrared Spectrophotometry ′(HJ 637-2018). The calculation formula of diesel degradation rate was as Eq. (1):
(1)
η=C0-CiC0×100%
where, η denotes the degradation rate of diesel oil; C0 represents the content of diesel oil in the blank sample system, mg/L; and Ci refers to the remaining diesel oil content in the system after microbial degradation, mg/L.

2.6. Degradation Pattern of Diesel Oil Component by Compound Bacteria

The group of compound bacteria with the best degradation effect were selected, and the degradation pattern with time course was further investigated. The components of diesel oil were analyzed by gas chromatography, which was performed on HP-5 quartz capillary column (30 m×0.32 mm, film thickness 0.25 μm). Gas chromatographic conditions were set as follows: the inlet temperature was 320 °C, the column flow rate was 2.0 mL/min, and the column temperature chamber temperature was initially maintained at 60 °C for 1 min, then increased to 290 °C at 8 °C /min, and then increased to 320 °C at 30 °C /min for 7 min. The temperature of FID detector was 330 °C, the hydrogen flow rate was 40.0 mL/min, the air flow rate was 350.0 mL/min, and the tail blow flow rate was 30.0 mL/min. The injection method involved non-split injection initially, followed by split injection after 0.75 min, with a split ratio of 30: 1, and an injection volume of 1 μL.

2.7. Migration Experiment of Compound Bacteria

In order to obtain an efficient TPH-degrading bacterial solution, three strains of C1A, B29 and NK4 were cultured in LB liquid medium at 30 °C for 30 h and mixed in a super clean workbench with a volume ratio of 1:1:1. Quartz sand with different particle sizes (coarse sand: 0.5–1 mm, medium sand: 0.25–0.5 mm, fine sand: 0.125–0.25 mm) was panned with dilute nitric acid solution with a concentration of 10% and soaked for 36 h. After soaking, the sand was washed repeatedly with deionized water until a neutral pH was reached, and then placed in an autoclave for autoclaving. Subsequently, the coarse sand, medium sand and fine sand media were filled into different plexiglass columns, and the filling process was continuously compacted to avoid the emergence of advantageous channels. Then, the quartz sand column was fully saturated with water, and the volume of the water was considered the pore volume. The experimental device is shown in Fig. S2, and the related sand column parameters are shown in Table S1.

Results and Discussion

3.1. Screening and Identification of Diesel Oil Degrading Bacteria

After screening, a total of 6 strains of diesel oil degrading bacteria were obtained, named NK1, NK2, NK3, NK4, B29 and C1A, respectively. The colony morphology and streak culture results are shown in Table S2 and Fig. S3 respectively. Some studies have shown that under the same conditions, Gram-positive bacteria have a lower surface charge compared to Gram-negative bacteria [26], potentially influencing their migration behavior in aquifers. So the Gram staining of the six strains was conducted and the results are shown in Table S2 and Fig. S4. All of the six strains showed red color after Gram staining, indicating that they were all Gram-negative bacteria. Under microscope, NK1, NK3 and NK4 were rod-shaped or rod-shaped bacteria, while NK2, B29 and C1A were globular or short rod-shaped bacteria. The strains were identified using 16S rRNA gene sequencing and analyzed by BLAST against the GenBank database. The strains were identified as Acinetobacter venetianus NK1, Pseudomonas aeruginosa NK2, Acinetobacter venetianus NK3, Pseudomonas guguanensis NK4, Alcaligenes faecalis B29 and Pseudomonas aeruginosa C1A (Fig.1).
The six strains were paired with each other to carry out antagonistic experiment. The antagonistic effect of the obtained 15 combinations were determined by measuring the inhibition zones between colonies, and the result was shown in Table S3. The colonies of the four groups of strains, NK1 and NK2, NK1 and NK3, NK1 and B29, and NK2 and NK3, had antagonistic effect between each other. And there were no antagonism between the other 11 groups of strains. The combination of antagonistic strains was removed according to the combination of three strains. In total, eight combinations were involved, including NK2/NK4/C1A, NK2/NK4/B29, NK2/C1A/B29, NK3/NK4/C1A, NK3/C1A/B29, NK4/B29/C1A, NK1/NK4/C1A, and NK3/NK4/B29. Subsequently, by comparing the degradation ability of the eight conbinations using diesel oil as the substrate, the efficient degradation conbination was selected.
Fig. 2a shows the degradation rates of both the compound agents and single bacterial strains. The degradation rates of NK1, NK2, NK3, NK4, B29 and C1A to oil-bearing water at 1 g/L were 59.99%, 45.61%, 23.49%, 51.95%, 33.53% and 62.66%, respectively. The combination of NK2/NK4/C1A, NK2/NK4/B29, NK2/ C1A/ B29, NK3/ NK4/ C1A, NK3/ C1A/ B29, NK4/ B29/ C1A, NK1/ NK4/ C1A, and NK3/ NK4/ B29 were 80.71%, 51.73%, 49.46%, 69.79%, 47.45%, 85.91%, 46.76% and 51.21%, respectively. Among them, the NK4/ B29/ C1A group had the highest degradation efficiency. The percentage of diesel degradation was higher than that reported by Ganesh and Lin [27], they reported a maximum percentage of diesel degradation of 80% using isolated microorganisms. Though the degradation rate of our bacteria is slightly lower than the consortia reported by Tiralerdpanich P [28], it important to consider that the inoculation amount of diesel was half in our study. This result demonstrated the compound bacteria had an enhanced degradation ability than single bacterial strain. In specific cases, combining multiple strains could enhance the degradation performance of bacterial strains by leveraging synergistic effects, where different strains promote each other in the process of degrading pollutants [29]. It could also be understood that there existed a complementary relationship between the metabolic forms of strains [30]. The metabolic function of compound bacterial relied on both the metabolic pathway of single strains and the metabolite exchange among the strains. The compound bacteria that can self-regulate and adapt during the degradation have a better degradation efficiency, which may explain why the NK4/ B29/ C1A had a better performance in the diesel oil degradation than the other compound bacteria in the study.
The residual products of diesel oil degraded by the compound bacteria were detected by GC-FID, and the TPH of the degradation products was divided into C10–C22. In this experiment, C10–C22 was divided into two groups for analysis, i.e., C10–C16 (low molecular semi-volatile) and C17–C22 (stubborn non-volatile). Among them, C17–C22 was polymer hydrocarbons and was not easy to biodegrade. Fig. 2b shows the change of diesel component proportion at different degradation times. With the increase of degradation time, the proportion of low carbon components in degradation products gradually decreased to zero, and the proportion of long carbon chain components increased. This indicated that the short chain TPH components were degraded prior to the long chain components during the diesel oil degradation. In addition, changes in the proportion of C10–C16 and C17–C22 components were calculated, and the results are shown in Table S4. As degradation time increased, the proportion of low-carbon components in the degradation products gradually decreased to zero, while the proportion of long-carbon chain components increased. The biodegradation of diesel oil pollutants involve sequential metabolic reactions catalyzed by enzymes. The degradation efficiency is depended on both the enzymatic activity, and the solubility, mobility and bioavailability of pollutants. Thus, our compound bacteria may preferentially degrade the short-chain TPH as the solubility and bioavailability of volatile components are stronger than that of non-volatile components. This result further confirmed that the compound bacteria degraded short-chain TPH components of diesel oil pollutants first [31].

3.2. Effects of Different Factors on the Degradation of Diesel Oil by Compound Bacteria

Microbial degradation of diesel oils is a complex reaction process involving both microbial and environmental factors. Efficient functional TPH-degrading strains alone are insufficient; favorable environmental conditions for microbial growth, reproduction, and metabolic activities are also essential. Therefore, in order to improve the efficiency of bioremediation of TPH-contaminated sites, the influence of environmental factors on the degradation of TPH by the compound bacteria (NK4/ B29/ C1A) should be necessarily explored. Fig. 3a presents the effect of pH on the degradation of diesel oil by compound bacteria. As shown in the figure, under different pH conditions, the degradation of diesel oil increased with time. At the same time, when the pH was 7, the residual amount of diesel oil after 28 d was 513.7 mg/L, and the corresponding degradation rate was 90.02%. However, the degradation rate of diesel oil significantly decreased when the pH was below 6 or above 9. This effect became more pronounced over time, as the growth of bacterial strains and the enzymatic activity may be inhibited in acidic and alkaline conditions. This result indicating the preferred pH of compound bacteria was pH 7–8.
Suitable temperature is important for bacterial growth and activity. On the one hand, the growth of many strains were slowly at low temperature, which was not favor for degradation due to the lack of enough biomass. On the other hand, many strain could not grow under high temperature because of the cell protein denaturing. Fig. 3b shows the influence of temperature on the degradation of diesel oil. At Day 7, when the temperature increased from 15 °C to 40 °C, the degradation rate of diesel oil increased correspondingly from 43.48% to 66.68%. This occurred might because the microbial biomass in the reaction system accumulated with time, and the activity of microorganisms was increased at suitable temperature. Many bacterial strains grew slowly at low temperature. At the same time, the solubility of diesel oil increased with the increase of temperature, and the easily degradable components were degraded by the compound bacteria in the early stage of degradation [32]. However, over time, the degradation rate of diesel oil initially increased and then decreased after 14 d. This trend might be attributed to higher temperatures reducing the activity of microbial enzymes or the inactivation of certain active substances, which hampered microbial growth and metabolism [33].
The varying amounts of inoculation resulted in differentiate loads of contaminated substrate shared by each cell in the system. Fig. 3c presents the degradation rate of diesel oil at different inoculations. With the increase of inoculant inoculations, the degradation efficiency of diesel oil also increased. When inoculations amount was 20%, the degradation rate of diesel oil reached 98.40% after 28 d.
Besides, it should be noted that when the inoculation amount was greater than 6%, the degradation efficiency of compound bacteria were only slightly increased. This occurred might because larger amount of bacteria would consume more nutrient [34]. Although the degradation effect was good in a short period of time, the lack of sufficient nutrients would still affect the degradation effect over time. As shown in Fig. 3d, the degradation amount and degradation rate of the compound bacteria presented different trends under different diesel concentration conditions. With the increase of diesel concentration, the degradation amount of diesel oil increased, but the degradation rate decreased. In other words, with the increasing concentration of diesel oil in the system, the degradation ability of microorganisms was restricted Besides, it might also be possible that the high concentration of diesel oil obstructed the oxygen exchange between the water body and the air, blocking the contact between the bacteria and oxygen [35].

3.3 Migration Performance of Mixed Diesel Oil Degrading Bacteria in Aquifers

In situ groundwater microbial remediation is conducted as follows: firstly, the compound bacteria is added into the aquifer through the remediation well, then they migrate to the groundwater pollution plume under the combined action of environmental and microbial factors, and finally degrade the pollutants [36]. The information of microbial migration in aquifers can be obtained through one-dimensional sand column experiment. The migration performance of bacteria is evaluated by penetration curve, which is measured by the ratio of bacterial concentration flowing out of sand column to flowing into sand column (C/C0). The greater value of the C/C0 indicates the greater the migration capacity of bacteria under this aquifer condition [37]. At the ionic strength of 1 mM CaCl2, the penetration curve of the compound bacteria under different medium particle sizes and injection flow rates is shown in Fig. 4a. In coarse sand, the plateau C/C0 of the penetration curve was 0.97, 0.92, and 0.89 at flow rates of 3.75 cm/min, 2.25 cm/min, and 0.75 cm/min, respectively. For medium sand, it decreased to 0.93, 0.90, and 0.88. In fine sand, the plateau C/C0 dropped to 0.87, 0.83, and 0.80. The penetration curves of the compound bacteria with 50 mM CaCl2 ion strength under different medium particle sizes and injection flow rates are shown in Fig. 4b. In coarse sand, the plateau C/C0 of the penetration curve at flow rates of 3.75 cm/min, 2.25 cm/min, and 0.75 cm/min was 0.88, 0.81, and 0.73, respectively. For medium sand, it decreased to 0.77, 0.69, and 0.57. In fine sand, the plateau C/C0 dropped to 0.67, 0.60, and 0.49. At the ionic strength of 100 mM CaCl2, the penetration curve of the compound bacteria under different medium particle sizes is shown in Fig. 4c. The penetration curve plateau C/C0 at pore flow rates of 3.75 cm/min, 2.25 cm/min and 0.75 cm/min was 0.78, 0.71 and 0.63, respectively. In medium sand medium, C/C0 decreased to 0.70, 0.62 and 0.54, respectively. In fine sand medium, C/C0 decreased to 0.60, 0.51 and 0.39, respectively.
These exprimental results indicated that medium particle size and flow velocity served as the main factors restricting the migration of compound bacteria in aquifers. The larger the particle size of porous media, the stronger the migration ability of microorganisms in it [38]. Higher flow rates generally result in stronger shear forces between water flow and the medium, providing kinetic energy for microorganisms and enhancing their migration capacity, thus reducing retention in the medium [39].
However, based on the experimental results, the change of ionic strength also had a great impact on the migration performance of compound bacteria in aquifers. Thus, the mechanism were further investigated by hydrodynamic diameter, zeta potential, adhesion efficiency and the deposition rate experiments. Malvern laser particle size analyzer was used to test the hydrodynamic diameter of the compound bacteria at three CaCl2 ionic strengths (1 mM, 50 mM and 100 mM), and the particle size distribution results of the compound bacteria are shown in Fig. 5. The median particle size d (0.5) of the compound bacteria was 0.757 μm at the ionic strength of 1 mM, 0.944 μm at the ionic strength of 50 mM, and 1.031 μm at the ionic strength of 100 mM. The increase in ionic strength from 1 mM to 100 mM led to an increase in the median particle size of the compound bacteria from 0.757 μm to 1.031 μm. This could be attributed to the compression of the double electric layer due to the higher ionic strength, resulting in reduced electrostatic repulsion between microorganisms. As a result, microorganisms were more likely to approach each other, forming larger aggregates. The enhancement of electrostatic effect on the surface of microorganisms contributed to the stability of these aggregates, leading to the adsorption or agglomeration in aquifers. Hence, the migration performance of compound bacteria became weakened at high ionic strength and the diameter of which was increased [40].
The Zeta potential of the compound bacteria at different ionic strengths is shown in Table S5. The results showed that with the increase of ionic strength, the Zeta potential of the compound bacteria gradually decreased. When the ionic strength increased from 1 mM to 100 mM, the Zeta potential of the compound bacteria decreased from −27.7±0.79 mV to −10.5±0.7 mV. This occurred because when the ionic strength increased, these ions were adsorbed on the surface of the microorganisms. Besides, a thick electric double layer was formed, resulting in a lower surface charge density [41].
Further, the adhesion efficiency (α) and deposition rate (Kd) at different ionic strengths were calculated, and the results are shown in Fig. 6. Under high flow velocity conditions, the deposition rate of fine sand reached its peak, and it exhibited the most substantial fluctuations as the ion strength increased. When the ion strength increased from 1mM to 100 mM, the deposition rate of the compound bacteria increased by 0.0039 s−1. On the contrary, the deposition rate of coarse sand was found to be the smallest under slow flow conditions and demonstrated the least responsiveness to variations in ionic strength. When the ionic strength increased from 1 mM to 100 mM, the deposition rate of the compound bacteria only increased by 0.00068 s−1. The α and Kd of the compound increased nonlinearly with the increase of ionic strength. α was introduced to mitigate the adhesion between nanoparticles and porous media, and it was directly related to the potential energy that governed the interaction between the nanoparticles and the aquifer materials [42]. With the increase of ionic strength, the double electric layer between the compound bacteria and the quartz sand medium was compressed, which reduced the electrostatic repulsion and promoted the deposition of the compound bacteria. For Kd in porous media, under a consistent ionic strength environment, fine sand demonstrated a higher deposition rate within the media compared to medium and coarse sands. Moreover, the deposition rate was higher at elevated fluid flow rates than at lower ones [43].

3.4. Distribution Characteristics of Mixed Diesel Oil Degrading Bacteria in Aquifer

Following the migration experiment, the sand column was sectioned at intervals of 1.5 cm to identify and analyze the types of microbial bacteria retained at various depths within the column. The experimental results are shown in Fig. 7. As shown in the figure, the allocation proportion of the three bacterial strains were different at different locations. Pseudomonas aeruginosa (C1A) had strong migration performance in the aquifer, followed by Alcaligenes_faecalis (B29) and Pseudomonas_guguanensis (NK4), and the retention abundance changed with the medium conditions. This might be attributed to the morphology of the bacteria itself. In fine sand medium, when the ion strength was 1mM, the injection rate was 0.75 cm/min, and the proportion of Pseudomonas_guguanensis decreased from 27.52% to 6.06% after passing through the 15 cm sand column. The proportion of Pseudomonas aeruginosa increased from 22.14% to 77.69%, while that of Alcaligenes_faecalis decreased from 41.11% to 14.05% (Fig. 7a). In the coarse sand medium, the proportion of Pseudomonas_guguanensis decreased from 30.94% to 8.76%, while that of Pseudomonas aeruginosa increased from 34.28% to 56.62 when the ion strength was 100 mM and the injection rate was 2.25 cm/min. The proportion of alcaligenes_faecalis increased from 34.46% to 34.54% (Fig. 7b). In comparison with the fine sand medium, compound bacteria exhibited a more evenly distributed migration pattern in the coarse sand medium. However, their proportion at each location were still differentiated from the original distribution.
Thus, when using compound bacteria for in-situ groundwater remediation, appropriate control measures should be adopted to ensure that various bacterial strains in the compound bacteria could be evenly distributed in the aquifer medium as far as possible, so as to maximize the removal efficiency of pollutants.

Conclusions

In this study, 1) a total of six bacterial strains belonged to three genera were successfully isolated from groundwater contaminated with diesel, including the Acinetobacter venetianus NK1, Pseudomonas aeruginosa NK2, Acinetobacter venetianus NK3, Pseudomonas guguanensis NK4, Alcaligenes faecalis B29 and Pseudomonas aeruginosa C1A. 2) A compound bacterial agent was obtained based on antagonistic relationship and diesel oil degradation ability. The NK4/ B29/ C1A agent achieved an impressive degradation efficiency of 85.91% for diesel oil at initial concentration of 1 g/L within 28 d, and the semi-volatile component C10-C16 has been degraded completely in 21 d. 3) The preferred degradation condition of NK4/ B29/ C1A were as follows: pH 7–8, temperature of 35–40 °C, inoculation amount of 6%–20%, and diesel oil concentration can be as high as 2 g/L. 3) The migration behavior of the compound bacteria in the aquifer medium was significantly influenced by the grain size of the geological formation, the velocity at which they were injected, and the ionic strength present within the groundwater. Specifically, the migration ability of compound bacteria was stronger in course particle size and high flow rate. The migration ability was inhibited under the consition of high ionic strength, which might owe to the formation of bacterial aggregate that increased the adhesion and deposition. It is worth noting that upon injection into the aquifer, it was observed that the compound bacteria tended to undergo a process of separation or dispersion. This may explain why the degradation rate of petroleum hydrocarbons can be achieved by the compound microbial agent in the laboratory, but the degradation effect of petroleum hydrocarbons becomes worse after being applied to the actual contaminated site.

Supplementary Information

Acknowledgments

This work was supported by the China National Petroleum Corporation Basic Science and strategic reserve technology research fund project (2022DQ03-A5).

Notes

Conflict-of-Interest Statement

The authors declare no competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Author contributions

J. F. L. (Professor) and J. C. X. (Professor) completed the conceptualization of the entire research content. T. X. Q. (PhD student) and X. Y. D. (Senior engineer) conducted all the experiments and wrote the manuscript. J. Z. (Senior engineer) and H. J. W. (Senior engineer) analyzed experimental data. C. Y. G. (Post-doctoral) wrote and revised the manuscript. J. J. Z. (Senior engineer) revised the manuscript.

References

1. Wu Y, Yu J, Huang Z, et al. Migration of total petroleum hydrocarbon and heavy metal contaminants in the soil–groundwater interface of a petrochemical site using machine learning: impacts of convection and diffusion. RSC Adv. 2024;14:32304–32313. https://doi.org/10.1039/D4RA06060A
crossref pmid pmc

2. Yanxun S, Yani W, Hui Q, Yuan F. Analysis of the groundwater and soil pollution by oil leakage. Procedia Environ. Sci. 2011;11:939–944. https://doi.org/10.1016/j.proenv.2011.12.144
crossref

3. Van Stempvoort DR, Lesage S, Novakowski KS. Humic acid enhanced remediation of an emplaced diesel source in groundwater. 1. Laboratory-based pilot scale test. J. Contam. Hydrol. 2022;54:249–276. https://doi.org/10.1016/S0169-7722(01)00182-6
crossref pmid

4. Chen CH, Whang LM, Pan CL, Yang C, Liu P W G. Immobilization of diesel-degrading consortia for bioremediation of diesel-contaminated groundwater and seawater. Int Biodeterior Biodegrad. 2017;124:62–72. https://doi.org/10.1016/j.ibiod.2017.07.001
crossref

5. Champagne P. Remediation technologies for soils and groundwater. ASCE. 2007;120–125. https://doi.org/10.1061/9780784408940
crossref

6. Zinatloo-Ajabshir S, Salavati-Niasari M. Preparation of magnetically retrievable CoFe2O4@SiO2@Dy2Ce2O7 nanocomposites as novel photocatalyst for highly efficient degradation of organic contaminants. Compos. Part B Eng. 2019;174:106930. https://doi.org/10.1016/j.compositesb.2019.106930
crossref

7. Zinatloo-Ajabshir S, Morassaei M S, Amiri O, Salavati-Niasari M, Foong L K. Nd2Sn2O7 nanostructures: Green synthesis and characterization using date palm extract, a potential electrochemical hydrogen storage material. Ceram. Int. 2020;46:17186–17196. https://doi.org/10.1016/j.ceramint.2020.03.014
crossref

8. Liu J, Cheng Y, Zhang F, Wen X, Yang L. Research hotspots and trends of groundwater and ecology studies: based on a bibliometric approach. J. Groundwater Sci. Eng. 2023;11:20–36. https://doi.org/10.26599/jgse.2023.9280003
crossref

9. Tang Z, Song X, Xu M, et al. Effects of co-occurrence of PFASs and chlorinated aliphatic hydrocarbons on microbial communities in groundwater: a field study. J. Hazard. Mater. 2022;435:128969. https://doi.org/10.1016/j.jhazmat.2022.128969
crossref pmid

10. Abtahi H, Parhamfar M, Saeedi R, et al. Effect of competition between petroleum-degrading bacteria and indigenous compost microorganisms on the efficiency of petroleum sludge bioremediation: field application of mineral-based culture in the composting process. J. Environ. Manage. 2020;258:110013. https://doi.org/10.1016/j.jenvman.2019.110013
crossref pmid

11. Wang B, Gao C, Li X, et al. Remediation of groundwater pollution by in situ reactive zone: a review. Process Saf. Environ. Prot. 2022;168:858–871. https://doi.org/10.1017/S0967090521000223
crossref

12. Liu H, Xu J, Liang R, Liu J. Characterization of the medium-and long-chain n-Alkanes degrading pseudomonas aeruginosa strain SJTD-1 and its alkane hydroxylase genes. PLoS One. 2014;9:e105506. https://doi.org/10.1371/journal.pone.0105506
crossref pmid pmc

13. Zhang X, Zheng M, Wang R, Liang C, Xu S. Screening of efficient hydrocarbon degrading bacteria Y-16 from petroleum contaminated soil and its degradation characteristics. Chin. J. Environ. Eng. 2010;8:1916–1920. https://doi.org/10.1631/jzus.A1000244
crossref

14. Wang A, Fu W, Feng Y, Song D, et al. Synergetic effects of microbial-phytoremediation reshape microbial communities and improve degradation of petroleum contaminants. J. Hazard. Mater. 2022;429:128396. https://doi.org/10.1016/j.jhazmat.2022.128396
crossref pmid

15. Ghazali FM, Rahman RNZA, Salleh AB, Basri M, et al. Biodegradation of hydrocarbons in soil by microbial consortium. Int. Biodeterior. Biodegrad. 2004;54:61–67. https://doi.org/10.1016/j.ibiod.2004.02.002
crossref

16. Li Q, Huang Y, Wen D, Fu R, Feng L, et al. Application of alkyl polyglycosides for enhanced bioremediation of petroleum hydrocarbon-contaminated soil using sphingomonas changbaiensis and pseudomonas stutzeri. Sci. Total Environ. 2020;719:137456. https://doi.org/10.1016/j.scitotenv.2020.137456
crossref pmid

17. Ruiqi , Yang , Gaosen , et al. Degradation of crude oil by mixed cultures of bacteria isolated from the Qinghai-Tibet plateau and comparative analysis of metabolic mechanisms. Environ. Sci. Pollut. Res. Int. 2018;26:1834–1847. https://doi.org/10.1007/s11356-018-3718-z
crossref pmid

18. Ghazali F M, Rahman R N Z A, Salleh A B, Basri M. Biodegradation of hydrocarbons in soil by microbial consortium. Int Biodeterior Biodegrad. 2004;54:61–67. https://doi.org/10.1016/j.ibiod.2004.02.002
crossref

19. Rambeloarisoa E, Rontani JF, Giusti G, Duvnjak Z, Bertrand J C. Degradation of crude oil by a mixed population of bacteria isolated from sea-surface foams[J]. Mar. Biol. 1984;83:69–81. https://doi.org/10.1007/BF00393087
crossref

20. Xu H, Sun Y, Gao B, Shi X, Li X. Retention and transport of PAH-degrading bacterium herbaspirillum chlorophenolicum FA1 in saturated porous media under various pPhysicochemical conditions. Water Air Soil Pollut. 2017;228:259. https://doi.org/10.1007/s11270-017-3441-2
crossref

21. Ye X, Cheng Z, Wu M, et al. Determining the mobility of polystyrene nano-plastic in saturated quartz sand-limestone porous media. Chem. Eng. Sci. 2022;260:117949. https://doi.org/10.1016/j.ces.2022.116564
crossref

22. Shi Y, Zhou H, Cao F, et al. Removal of microorganisms and influencing factors in porous media. Microbiology China. 2023;50:1639–1652. https://doi.org/10.13344/j.microbiol.china.220978
crossref

23. Li X, Xu H, Gao B, Wu J. Transport of a PAH-degrading bacterium in saturated limestone media under various physicochemical conditions: common and unexpected retention and remobilization behaviors. J. Hazard. Mater. 2019;380:120858. https://doi.org/10.1016/j.jhazmat.2019.120858
crossref pmid

24. Qu D, Ren H, Zhou R, Zhao Y. Visualisation study on pseudomonas migulae AN-1 transport in saturated porous media. Water Res. 2017;122:329–336. https://doi.org/10.1016/j.watres.2017.06.012
crossref pmid

25. Cui J, Li Y, He Q, Li B, Yuan Y, Wen J. Effects of different surfactants on the degradation of petroleum hydrocarbons by mixed-bacteria. J. Chem. Technol. Biotechnol. 2022;97:208–217. https://doi.org/10.1002/jctb.6931
crossref

26. Chen G, Walker S L. Fecal indicator bacteria transport and deposition in saturated and unsaturated porous media[J]. Environ. Sci. Technol. 2012;46:8782–8790. https://doi.org/10.1021/es301378q
crossref pmid

27. Ganesh A, Lin J. Diesel degradation and biosurfactant production by Gram-positive isolates. Afr. J. Biotechnol. 2009;21:5847–5854. https://doi.org/10.5897/AJB09.811
crossref

28. Tiralerdpanich P, Sonthiphand P, Luepromchai E, Pinyakong O, Pokethitiyook P. Potential microbial consortium involved in the biodegradation of diesel, hexadecane and phenanthrene in mangrove sediment explored by metagenomics analysis. Mar. Pollut. Bull. 2018;133:595–605. https://doi.org/10.1016/j.marpolbul.2018.06.015
crossref pmid

29. Lu L, Huggins T, Jin S, Zuo Y, Ren Z. Microbial metabolism and community structure in response to bioelectrochemically enhanced remediation of petroleum hydrocarbon-contaminated soil. Environ. Sci. Technol. 2014;48:4021–4029. https://doi.org/10.1021/es4057906
crossref pmid

30. Meng L, Liu H, Bao M, Sun P. Microbial community structure shifts are associated with temperature, dispersants and nutrients in crude oil-contaminated seawaters. Mar. Pollut. Bull. 2016;111:203–212. https://doi.org/10.1016/j.marpolbul.2016.07.010
crossref pmid

31. Gao C, Zhang Y, Han Z, et al. Fenton pre-oxidation followed by microbial degradation for removing crude oil from contaminated soil. China Pet. Process. Petrochem. Technol. 2019;21:84–92. https://doi.org/10.1021/es010802+
crossref pmid

32. Zuo R, Xue Z, Zhai Y, et al. Construction, application and validation of a new algorithm for determining light nonaqueous- phase liquid fluxes in unsaturated zones. J. Environ. Manage. 2022;321:115934. https://doi.org/10.1016/j.jenvman.2022.03.010
crossref pmid

33. Zaher A M, Guo H, Wang R, et al. Effects of high temperature on water quality, growth performance, enzyme activity and the gut bacterial community of shrimp (Litopenaeus vannamei). Aquaculture Res. 2022;9:1–14. https://doi.org/10.1111/are.15836
crossref

34. Wang X, Zheng J, Han Z, Chen H. Bioremediation of crude oil-contaminated soil by hydrocarbon-degrading microorganisms immobilized on humic acid-modified biofuel ash. J. Chem. Technol. Biotechnol. 2019;94:1904–1912. https://doi.org/10.1002/jctb.5969
crossref

35. Bravo V, Spyra RW, Antaño-López R. Biodegradation of high concentrations of benzene and diesel in a fixed-Film reactor. Water Air Soil Pollut. 2009;204:1–4. https://doi.org/10.1007/s11270-009-0049-1
crossref pmid pmc

36. Suthersan S. Remediation engineering: design concepts. CRC Press; 2007. 123–124. https://doi.org/10.1201/9781315367088


37. Yu Z, Hu L, Lo I M C. Transport of the arsenic (As)-loaded nano zero-valent iron in groundwater-saturated sand columns: roles of surface modification and As loading. Chemosphere. 2019;216:428–436. https://doi.org/10.1016/j.chemosphere.2018.10.125
crossref pmid

38. Syngouna VI, Chrysikopoulos CV. Transport of biocolloids in water saturated columns packed with sand: effect of grain size and pore water velocity. J. Contam. Hydrol. 2011;126:301–314. https://doi.org/10.1016/j.jconhyd.2011.09.007
crossref pmid

39. Walshe G E, Pang L, Flury M, Close M E, Flintoft M. Effects of pH, ionic strength, dissolved organic matter, and flow rate on the co-transport of MS2 bacteriophages with kaolinite in gravel aquifer media. Water Res. 2010;44:1255–1269. https://doi.org/10.1016/j.watres.2009.11.034
crossref pmid

40. Rawat S, Pullagurala V L R, Adisa I O, Wang Y, Peralta-Videa J, Gardea-Torresdey J. Factors affecting fate and transport of engineered nanomaterials in terrestrial environments. Curr Opin Environ Sci Health. 2018;6:47–53. https://doi.org/10.016/j.coesh.2018.07.014
crossref

41. Schinner T, Letzner A, Liedtfee S, Castro F D, Eydelnant I A, Tufenkji N. Transport of selected bacterial pathogens in agricultural soil and quartz sand. Water Res. 2010;44:1182–1192. https://doi.org/10.1016/j.watres.2009.12.021
crossref pmid

42. Ren Z, Gui X, Xu X, Zhao L, Cao X. Microplastics in the soil-groundwater environment: aging, migration, and co-transport of contaminants-a critical review. J. Hazard. Mater. 2021;419:126455. https://doi.org/10.1016/j.jhazmat.2020.126455
crossref pmid

43. Li X, Xu H, Gao B, Yang Z, Shi X, Wu J. Cotransport of Herbaspirillum chlorophenolicum FA1 and heavy metals in saturated porous media: effect of ion type and concentration. Environ. Pollut. 2019;254(Pt A)112940. https://doi.org/10.1016/j.envpol.2019.07.108
crossref pmid

Fig. 1
Phylogenetic tree of six purified strains. a) NK1; b) NK2; c) NK3; d) NK4; e) B29; f) C1A
/upload/thumbnails/eer-2024-335f1.gif
Fig. 2
a) Degradation rates of diesel oil by different compound bacteria; and b) Relative content of different components in degradation products
/upload/thumbnails/eer-2024-335f2.gif
Fig. 3
Effects of different factors on the degradation of diesel oil by compound bacteria. a) pH; b) Temperature; c) Inoculation amount; and d) Initial concentration of diesel fuel.
/upload/thumbnails/eer-2024-335f3.gif
Fig. 4
Penetration curve of compound bacteria in sand column. a) An ion strength of 1 mM; b) An ion strength of 50 mM; and c) An ion strength of 100 mM.
/upload/thumbnails/eer-2024-335f4.gif
Fig. 5
Fluid mechanics diameter of compound bacteria. a) ionic strength 1 mM; b) ionic strength 50 mM; and c) ionic strength 100 mM
/upload/thumbnails/eer-2024-335f5.gif
Fig. 6
a) Adhesion efficiency α; and b) the deposition rate Kd of diesel oil degrading bacteria
/upload/thumbnails/eer-2024-335f6.gif
Fig. 7
Retention ratio of compound bacteria in sand column. a) Fine sand, with an ionic strength of 1 mM, and an injection flow rate of 0.75 cm/min; b) Coarse sand, with an ionic strength of 100 mM, and an injection flow rate of 2.25 cm/min.
/upload/thumbnails/eer-2024-335f7.gif
TOOLS
PDF Links  PDF Links
PubReader  PubReader
Full text via DOI  Full text via DOI
Download Citation  Download Citation
Supplement  Supplement
  Print
Share:      
METRICS
0
Crossref
0
Scopus
2,194
View
76
Download
Editorial Office
464 Cheongpa-ro, #726, Jung-gu, Seoul 04510, Republic of Korea
FAX : +82-2-383-9654   E-mail : eer@kosenv.or.kr

Copyright© Korean Society of Environmental Engineers.        Developed in M2PI
About |  Browse Articles |  Current Issue |  For Authors and Reviewers