| Home | E-Submission | Sitemap | Contact Us |  
Environ Eng Res > Volume 29(5); 2024 > Article
Song, Kim, Choi, Seo, and Cho: Combinatorial effects of UVC irradiation and peroxymonosulfate on the inactivation of Aspergillus flavus and aflatoxin B1 accumulation

Abstract

Aspergillus flavus and its mycotoxin aflatoxin (AF) are widely present in the environment and cause various acute and chronic diseases in humans and animals. UV irradiation has been a versatile method for disinfecting A. flavus and detoxifying AFs. Combined effects of UV and other agents were scarcely tested yet. Here, we investigated the combinatorial effects of UVC and peroxymonosulfate (PMS) on the disinfection of A. flavus and accumulation of AFB1 under aqueous conditions. UVC efficiently disinfected A. flavus in a dose-dependent manner. PMS (~4 mM) exhibited no disinfection but enhanced the inactivation activity of UVC. Notably, PMS or UVC (72 J/cm2) increased the accumulation of AFB1 in the mycelia. Higher (144 J/cm2) doses of UVC suppressed AFB1 accumulation. At the genetic level, PMS and UVC upregulated the expression of the AF biosynthetic genes aflS and aflR. In contrast, UVC degraded AFB1 in vitro, which was enhanced by PMS treatment. The in-vivo and in-vitro studies indicated that AFB1 accumulation may be compromised by the dual effects of UVC and PMS on the upregulation of AF biosynthesis and degradation activities. In conclusion, PMS and UVC are efficient disinfecting agents against A. flavus but also stimulate AF biosynthesis under moderate treatment conditions.

1. Introduction

Aspergillus flavus is a pathogenic fungus that contaminates various agricultural products (e.g., grains and nuts) and the surfaces of our living environments [1]. Acute or chronic exposure to A. flavus is detrimental to human health as it causes an infectious disease called aspergillosis. In particular, A. flavus produces a notorious mycotoxin known as aflatoxin (AF), which is regarded as a hepatocarcinogen (Group 1) and is potentially carcinogenic to humans (Group 2 B), as categorized by the World Health Organization (WHO)-International Agency for Research on Cancer (IARC). It also causes acute aflatoxicosis in the liver that can lead to death. Based on their molecular structures, AFs are classified as B1, B2, G1, G2, M1, and M2 [2]. Among them, the B1 type of AFs (AFB1) is the most toxic and is found at the highest concentration in food and animal feeds [3]. Even at low concentrations (ppb), AFs can be lethal to immunocompromised humans and infants. The maximum AF level recommended by the Codex Alimentarius Commission is 10–15 mg/kg in food. The Food and Drug Administration (FDA) in the United States has set a limit of 20 ppb for total AFs in food (0.5 ppb for AFM1 in milk). In the European Union (EU), the maximum allowable limits of AFM1 and AFB1 are 0.025 and 1.0 ppb, respectively, for infant foods.
AF synthesis is facilitated by various environmental stimuli, such as pH, light, nutrients, and oxidative stresses [4]. These factors trigger cell signaling pathways that are merged into the regulation of AF synthesis genes located in a gene cluster comprising 30 genes. The activation of this cluster is largely regulated by two transcription factors: aflR and aflS [5, 6]. In a metabolic aspect, norsolorinic acid (NA) was known as the first stable intermediate in the AF synthesizing pathway. NA is converted to averantin through the catalytic action of ketoreductase, which is a critical step in AF biosynthesis [7]. Ketoreductase is encoded by aflD, whose disruption abolishes AF accumulation in A. parasiticus.
The disinfection of A. flavus and other Aspergillus spp. has been achieved using various physicochemical methods and agents, such as ultraviolet (UV) irradiation [8, 9], plasma [10, 11], photocatalysts [12], chlorination [13, 14], and acid mixtures [15]. Recently, UV-activated advanced oxidation processes (AOPs), which utilize oxygen radicals driven by TiO2, O3, and H2O2, have been found to be efficient in disinfecting the aforementioned organisms. Among these, sulfate-radical-based AOPs (SR-AOPs) have been used to disinfect microbes and degrade organic micropollutants. In particular, peroxymonosulfate (PMS), activated by UV light or other oxidants, efficiently inactivates fungi [16, 17] and degrades mycotoxins [18] and micropollutants [19, 20]. Nevertheless, the effect of PMS on the disinfection of Aspergillus has scarcely been investigated and is yet to be examined in A. flavus.
The detoxification of AFs has been tested using various physical, chemical, and biological agents. UV irradiation has been reported to efficiently degrade AFs in a broad-surface matrix [2123]. The cellular toxicity of the degradation products of AF under UV treatment was lower when tested in human embryo hepatocytes [24]. Chemical treatments, such as chlorination, oxidation, and hydrolysis, are also known to be effective [25]. In particular, the lactone ring of the coumarin molecule in AF is sensitive to alkaline hydrolysis, ammonia, and hypochlorite [26, 27]. Additionally, biological approaches using microorganisms, biofilms, and enzymes have been suggested for the treatment of AFs [28, 29]. However, the precise mechanisms of detoxification, particularly at the molecular level, are poorly understood. In particular, the effects of PMS on AF production or degradation have not been investigated.
In this study, we examined the disinfection efficiency of PMS activated by UVC against the conidia and mycelia of A. flavus at various doses of UVC and/or PMS to understand the role of PMS in fungal disinfection and mycotoxin accumulation. The accumulation levels of AFB1 in mycelia under the same treatment conditions were assessed in terms of the molecular and genetic aspects. Additionally, the degradation activity of UVC and/or PMS on AFB1 was measured in vitro. The potential mechanisms of action of PMS and UVC in the inactivation of the conidia/mycelia of A. flavus and AF accumulation were discussed in detail.

2. Materials and Methods

2.1. Fungal Strain

Aspergillus flavus (KACC 41730) was purchased from the Korean Agricultural Culture Collection. Mycelia of A. flavus were initially inoculated in 2 mL of MP media (malt extract 10 g/L, bacto-peptone 10 g/L, pH 7.4) and cultured with gentle shaking at 25°C for 24 h. Subsequently, this seed culture was sub-cultured in 500 mL of potato dextrose broth (PDB, Difco Co., USA) by stationary incubation for seven days at 25°C. Propagated mycelia were harvested by centrifugation at 4,000 rpm for 10 min and washed thrice with phosphate buffered saline (PBS; pH 7.2; Sigma-Aldrich Co., USA).
To produce conidia, collected mycelia were re-inoculated onto potato dextrose agar (PDA, Difco Co., USA) plates, followed by incubation at 25°C. After seven days, conidia were collected by adding sterilized 0.1% Tween-80 solution, followed by filtering through sterile Miracloth (Millipore, Billerica, MA). Conidia were harvested by centrifugation at 4,000 rpm for 10 min and washed thrice with PBS. The number of viable conidia was determined by assessing the colony forming units (CFU) per milliliter on PDA plates and adjusted to approximately 3 × 107 CFU/mL for the conidial inactivation experiments.

2.2. Inactivation of Fungal Conidia and Mycelia

The conidial disinfection experiments were conducted using a bench-scale collimated-beam apparatus equipped with a collimation tube under a UVC lamp [30]. UVC light was irradiated from three 4-W low-pressure mercury vapor UVC lamps (Philips Co., Netherlands). The UVC light intensity at 254 nm was measured using a radiometer equipped with a UV 254 detector (UVX Radiometer, UVP Co., USA). Before the disinfection experiments, the UVC lamps were turned on and stabilized for at least 30 min to ensure a constant UVC intensity output. Thirty milliliter of PBS was poured into a sterile Pyrex crystallizing dish (diameter and height of 70 and 40 mm, respectively) placed perpendicular to the incident light to initiate the experiment and subjected to stirring. In the case of PMS, 100 mM of stock solution was prepared by dissolving Oxone® (Sigma-Aldrich Co., USA) in deionized water. Considering the fungal inactivation assay, conidia of A. flavus were added to the dish to obtain approximately 8 × 105 CFU/mL. Subsequently, the suspension was treated with a series of dosages of UVC (0 to 144 mJ/cm2) and/or PMS (0, 1, 2, and 4 mM) at room temperature (20 ± 1°C). After the designated time course, Na2S2O3 (Sigma-Aldrich Co., USA) was added to instantaneously quench the residual disinfecting activity of PMS.
The efficiency of disinfection against mycelia was assessed by monitoring the growth recovery after treatment. Initially, mycelia were adjusted to A630nm = 0.8–1.0 (equivalent to 3–4 mg/mL) using a UV/Vis spectrophotometer (Agilent 8453, Agilent Co., USA) [31]. The mycelial suspension was exposed to UVC and/or PMS under the same conditions as those for the conidia. After treatment, the mycelia were collected and loaded onto sterilized paper discs (8 mm in diameter). Subsequently, the disc was placed onto a PDA plate and incubated at 25°C for the growth recovery. The radius of the mycelial zone was measured using a ruler after 48 h.

2.3. The Quantification of AFB1 in Mycelia

The mycelia exposed to UVC and/or PMS were then freeze-dried. Subsequently, the metabolites in 0.1 g of mycelia were extracted by 5 mL of 70% methanol containing 2% NaCl for 0.5 h at room temperature. The amount of AFB1 was quantified according to the instructions provided with the AFB1 ELISA kit (Elabscience®, USA). Standards of AFB1 were prepared in brown glass vials (0, 0.03, 0.06, 0.12, and 0.48 ppb). Standards and samples were prepared in triplicate and transferred to microwell plates, and the absorbance was measured at 450 nm using a microplate reader (Tecan, Schweiz). The concentration of AFB1 in each treatment condition was calculated based on a standard curve.

2.4. In vitro AFB1 Degradation

The standard AFB1 chemical (2, 3, 6aR, 9aS-tetrahydro-4-methoxy-1H, 11H-cyclopenta [c] furo [3′, 2′:4, 5] furo [2, 3-h] [1] benzopyran-1, 11-dione) was purchased from Sigma-Aldrich Co. (USA). The AFB1 stock solution was prepared to achieve a concentration of 5,000 ppm using dimethyl sulfoxide (DMSO; Sigma-Aldrich Co., USA). Subsequently, AFB1 was adjusted to 150 ppb for the degradation assay. After the designated treatments, the residual amount of AFB1 in the assay solution was quantified by high-performance liquid chromatography (HPLC; Agilent Technologies, 1220 Infinity II LC, USA) with a C18 reverse-phase column (Agilent Technologies Zorbax Eclipse Plus C18, 5 μm, 4.6 × 250 mm, USA) and UV detector at 365 nm. A solvent mixture of water/methanol/ acetonitrile (50%/40%/10%) was used as the mobile phase (flow rate: 0.8 mL/min).

2.5. The Quantitative PCR of AFB1 Synthetic Genes

Mycelia of A. flavus treated with UVC and/or PMS were collected, snap-frozen in liquid nitrogen, and ground to a fine powder in a microcentrifuge tube containing tungsten beads using a TissuseLyser LT (Qiagen, Germany). Total RNA was isolated from 100 mg of powdered mycelia using the LaboZol Reagent (LaboPass, Seoul, Korea) according to the manufacturer’s instructions. The purity and quantity of RNA were measured using a NanoDrop One instrument (Thermo Fisher Scientific, USA). Subsequently, the first strand of cDNA primed with oligo-dT was synthesized using AMPIGENE® cDNA Synthesis Kit (Enzo, USA).
The primers of target genes (aflD, aflS, and aflR) and housekeeping gene (β-tubulin) were designed using Primer3 v. 0.4.0 (bioinfo.ut.ee/primer3-0.4.0) (Table 1). Real-time quantitative polymerase chain reaction (qPCR) was conducted using the Topreal qPCR kit (Enzynomics, Korea). The reaction was conducted in 20 mL tube containing the following: 50 ng of cDNA sample, qPCR 2X premix (SYBR Green with low 6-carboxyl-X-rhodamine (ROX)), 0.8 mM of each primer, and RNase-free water. The conditions of the thermocycler were as follows: initial denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 15 s, and extension at 72°C for 20 s using the Bio-Rad CFX96 platform (Bio-Rad, USA).
Relative expressions of the genes among the conditions were determined by the 2−ΔΔC T method [32]. The CT values for every gene (b-tubulin, aflD, aflS, and aflR) were obtained by real-time PCR. The relevant parameters were calculated as follows: ΔΔCT = ΔCT (Ave. treated sample) - ΔCT (Ave. untreated sample), and ΔCT = CT (gene of test; aflD, aflS, and aflR) - CT (housekeeping gene; β-tubulin).

2.6. Statistical Analysis

The statistical reliability of the data was tested using either Student’s t-test or two-way analysis of variance (ANOVA) using a general linear model (GLM). The significance of differences among the mean values was determined using Duncan’s new multiple range test in the R statistical software 4.2.0 (https://www.r-project.org/). Data are presented as mean ± standard deviation. Statistical significance was determined at the 95 or 99% significance level (p < 0.05, p < 0.01).

3. Results

3.1. The Effect of PMS and/or UVC on the Inactivation of A. flavus Conidia

Previously, UV irradiation (~100 mJ/cm2) achieved reasonable disinfection against various fungi [16]. PMS (approx. 2 mM) in combination with other agents also efficiently inactivated the spores of several fungal species [17]. In the current study, within the similar dosage ranges, we examined the inactivation efficiencies of PMS and/or UVC against the conidia of A. flavus in an aqueous environment. When using PMS at concentrations of 0, 1, 2, and 4 mM, no measurable inactivation of the conidia was observed for up to 10 min (Fig. 1a). However, upon UVC irradiation, A. flavus conidia were rapidly inactivated and increased in number with increasing UVC doses (Fig. 1a). UVC achieved 0.4 log and 3 log reductions in fungal viability at doses of 36 and 108 mJ/cm2, respectively. However, during co-treatment with PMS and UVC, the inactivation efficiency against the conidia of A. flavus was higher than that with UVC alone (Fig. 1b). At a UV dose of 108 mJ/cm2, the inactivation level of conidia reached 3 log and 3.5 log reductions in the absence and presence of 4 mM PMS, respectively. Overall, PMS alone exhibited nearly no disinfection activity but markedly enhanced the inactivation efficiency of UVC against conidia compared with UVC treatment alone.

3.2. The Effect of PMS and/or UVC on the Inactivation of A. flavus Mycelia

On physicochemical treatment, the conidia and mycelia of fungi may become susceptible at different levels. Additionally, the inactivation activity of each treatment may have resulted in different fungal growth recovery rates. Based on these results, we examined the recovery of mycelial growth of A. flavus after treatment by measuring the diameter of mycelia grown on PDA after 48 h of treatment. Under the non-treated (NT) condition, the average diameter of the mycelia reached 4.7 cm on average (Fig. 2). After treatment with 4 mM PMS for up to 12 min, no reduction was observed in mycelial growth compared with treatment under the NT conditions. However, after UVC irradiation, the growth of mycelia was significantly reduced with increasing UV doses. Under UVC irradiation at 144 mJ/cm2, the average diameter of the mycelia was 2.2 cm on average. In contrast, the combined treatment of UVC and PMS (4 mM) also inhibited the recovery of mycelial growth, but at a similar level (2.1 cm) to UVC treatment alone. Overall, UVC irradiation per se markedly inactivated mycelial viability during recovery. The additive or synergistic effects of PMS on the inactivation efficiency of UVC against mycelia were negligible under our experimental conditions.

3.3. The Effect of PMS and/or UVC on the Production of Aflatoxin B1 in Mycelia

A. flavus produces various types of AFs, which belong to a family of potent mycotoxins. The most potent and abundant type is AFB1. AF synthesis is regulated by several environmental factors [3032]. Therefore, AF production may fluctuate when the fungal conidia or mycelia are exposed to physicochemical treatments. To investigate the effects of PMS and/or UVC treatments on AF production or accumulation in A. flavus, we measured the contents of AFB1 in the mycelia after 24 h of recovery following various disinfection treatments. First, we measured the concentration of AFB1 immediately after treatment (i.e., 0 h after recovery), which reflected the accumulation of AFB1 during treatment. Under NT conditions, the concentration of AFB1 was approximately 0.50 ppb per 0.1 g of mycelia (Fig. 3a). Treatment with PMS alone and co-treatment of PMS and UVC exhibited similar AFB1 levels to the treatment under NT conditions. However, UVC treatment slightly reduced the accumulation of AFB1 after 6 (0.48 ppm) and 12 (0.47 ppm) min of exposure.
After 24 h of recovery, the amount of AFB1 increased, showing variation among treatments (Fig. 3a). To further elucidate the effects of UVC/PMS on the accumulation of AFB1 in the recovery processes, we calculated [AFB1 24hrs-AFB1 0hr], which represents the difference between the amounts of AFB1 after 0 and 24 h of recovery following each treatment (Fig. 3b). Under NT conditions, [AFB1 24hrs-AFB1 0hr] was 0.05 ppb, indicating the marginal increase in AFB1 production in mycelia for 24 h of recovery. Notable, under the treatment at 4 mM PMS, AFB1 accumulation was facilitated with increasing exposure time compared with treatment under the NT condition. The [AFB1 24hrs-AFB1 0hr] values between 6 and 12 min of treatment at 4 mM PMS were 0.07 and 0.09 ppb, respectively. However, under UVC irradiation, the pattern of AFB1 production was different than that under PMS treatment. When UVC was irradiated for 6 min (72 J/cm2) and 12 min (144 J/cm2), [AFB1 24hrs-AFB1 0hr] values were 0.08 and 0.06 ppb, respectively. This indicates that the accumulation of AFB1 slightly increased under a low UVC dosage, which was mitigated under higher doses of UVC irradiation. Conversely, under the combined treatment of UVC and PMS, the [AFB1 24hrs-AFB1 0hr] value was similar to that under the NT conditions for 6 min (72 J/cm2) but slightly increased after 12 min of treatment (144 J/cm2). Overall, the accumulation of AFB1 increased after treatment with 4 mM PMS and a lower dose of UVC irradiation (72 J/cm2). However, AFB1 accumulation decreased at higher doses of UVC irradiation. The AFB1 content after the co-treatment of UVC and PMS appeared to be compromised by the positive and negative effects of PMS and UVC, respectively, on AFB1 accumulation.

3.4. The Effect of UVC and/or PMS on the Expression of the Biosynthetic Genes of Aflatoxin

The increase or decrease in the amount of AFB1 under each condition implied that UVC and/or PMS induced the de-novo biosynthesis and/or degradation of AFB1 in the mycelia. To further investigate this phenomenon, we examined whether UVC and/or PMS modified the biosynthesis of AFB1 by monitoring the expression levels of genes regulating AFB1 biosynthesis under each condition. After 6 or 12 min of each treatment, the mycelia were sampled at 0 and 24 h after recovery. First, we examined the expression level of a structural gene, namely, aflD, among the genes located in the AF biosynthetic cluster of the genome. Under most conditions, the expression level of aflD stabilized and exhibited no induction or reduction according to the treatments in the designated time courses (Fig. 4a). Although the expression level of aflD after 24 h of recovery following 6 min of treatment with PMS significantly changed among the treatment conditions, its fold change was marginal (i.e., 1.2-fold) compared with that under the NT condition at 0 h of recovery. We specifically selected two genes (aflS and aflR) encoding transcription factors that regulate AFB1 biosynthesis and estimated the expression levels of these genes in the mycelia after 0 and 24 h of recovery following each treatment (Figs. 4b and 4c). Notably, immediately after harvesting mycelia (i.e., 0 h), the expression of aflS slightly increased throughout most of the UVC- and/or PMA-treated conditions compared with that under the NT condition. This indicated that the expression of aflS was upregulated during UVC and/or PMS treatments. After 24 h of recovery, the expression of aflS increased by two-fold compared with that after 0 h of recovery under NT conditions. Notably, after PMS treatment for 6 and 12 min, the expressions of aflS were induced by more than three-fold compared with that under NT conditions after 24 h of recovery. In contrast, under UVC irradiation, the induction level of aflS after 24 h of recovery exhibited no changes compared with that under NT conditions. This implied that the effect of UVC on the upregulation of aflS was marginal compared with that of PMS. However, under the combined treatment of UVC and PMS, the expression of aflS showed complex patterns. After 6 min of treatment with UVC (72 mJ/cm2) and 4 mM PMS, no significant changes were observed in aflS expression between 0 and 24 h of recovery. However, after prolonged treatment (12 min) with UVC and PMS, the expression of aflS increased by three-fold compared with that at 0 h of recovery. Although the interpretation of these results was intriguing, they suggested that PMS and UVC upregulated aflS activity with the prevalence of PMS.
In the case of the aflR gene, the overall patterns in the expression profile under each condition were similar to those of aflS (Fig. 4c). The expression levels of aflR increased during recovery after PMS treatment. After UVC treatment, with increasing doses, the induction level of aflR was mitigated. Under the combined treatment of UVC and PMS, the expression of aflR displayed a compromised pattern between PMS and UVC, which was similar to that of aflS. Collectively, the expression of AFB1 biosynthetic genes was upregulated by both PMS and UVC treatments. PMS induced a much greater upregulation of AFB1 biosynthetic genes than UVC under the tested conditions.

3.5. In vitro Degradation of Aflatoxin B1 by UVC/PMS Treatment

The degradation or modification of AFB1 could also affect the accumulation of AFB1 in the mycelia. To examine this hypothesis, we estimated the degradation efficiency of AFB1 standards under different doses of UVC irradiation and/or a series of PMS concentrations in vitro. The degradation of AFB1 was determined using [AFB1]/[AFB1]0 at designated time points by measuring the detected AFB1 peaks using HPLC (Fig. 5). In the presence of 1, 2, or 4 mM PMS, AFB1 standards showed no degradation for up to 40 min. Under UVC irradiation (approximately 144 mJ/cm2), AFB1 was marginally degraded. However, with further increases in the UVC dose, the degradation of AFB1 gradually increased. Approximately 17% of AFB1 was degraded within 40 min (1200 mJ/cm2 with an intensity of 0.5 mW/cm2). Notably, under the combined treatment of UVC and PMS, the degradation of AFB1 was facilitated. In particular, 70% AFB1 was degraded within 40 min under the co-treatment of UVC irradiation (1200 mJ/cm2) and PMS (4 mM). The in-vitro assay with AFB1 revealed that UVC degraded AFB1 but required a high dose for treatment. PMS per se showed no degradation activity against AFB1 but enhanced the degradation efficiency of UVC during co-treatment.

4. Discussions

Various physicochemical agents and methods have been developed to disinfect fungi and their toxins from an array of environments. Among them, UVC irradiation is the most versatile method owing to its efficiency, cost-effectiveness, and ecofriendliness. Currently, the incorporation of additional agents or methods into the UVC is being investigated and optimized to improve disinfection. In particular, PMS is known to have additive or synergistic effects on UVC irradiation against various fungi but not against A. flavus. In this study, we demonstrated the positive roles of UVC and PMS in the inactivation of A. flavus. Additionally, we revealed the dual roles of UVC and PMS in the accumulation and degradation of its mycotoxin, AFB1, for the first time. PMS enhances the disinfection efficiency of UVC against the conidia of A. flavus but not against its mycelia. Under in-vitro conditions, UVC treatment alone and in combination with PMS degraded AFB1 in a dose-and time-dependent manner. Paradoxically, PMS and UVC increased the accumulation of AFB1 in the mycelia of A. flavus during recovery. This is supported by the upregulation of key AFB1 biosynthetic genes. Based on our data, the accumulation of AFB1 in the mycelia can be ascribed to the dual effects of UVC and/or PMS on the degradation and biosynthesis of AFB1.
In our study, 108 mJ/cm2 of UVC was required to achieve 3 log inactivation of A. flavus (Fig 1). In the presence of 4 mM of PMS, less UV dose (92 mJ/cm2) was required for the similar inactivation efficiency, indicating the enhancement of UV-mediated disinfection by PMS. Such positive effects of UV and PMS on disinfection were also documented in various fungi [9, 16, 17]. Inactivation kinetics of UV and/or PMS against four dominant genera of fungi exhibited that combined treatment of UV (25–100 mJ/cm2) and PMS (0.1 mM) markedly increased the inactivation activities compared to the single treatment of UV [14]. When used with chlorination, PMS (~2 mM) also increased the inactivation efficiencies against multiple fungal genera [17]. The differences in dosages of UV and PMS among each of studies were ascribed into the turbidity and ion concentrations in the reaction solution [9]. On the other hand, PMS per se exhibited limited disinfection activity against fungi. The disinfection efficiency of PMS was largely depending on its radical formations (i.e. SO4 ×− and ×OH) activated by co-treatment with other agents such as UVC, chloride, or metal ions. Based on this, low disinfection activity of PMS was likely due to the lack of reactive radical species. Mechanistically, it is well known that the roles of such radicals were to target the disintegration of the cell walls and membranes of fungi, resulting the leakage of intracellular components and caused cell death. Nevertheless, our study verified that combined treatment of UVC and PMS could be versatile UV-AOP (advanced oxidation process) to disinfect the contamination of A. flavus in water.
In contrast to that of conidia, the inactivation of mycelia was not improved by PMS under UVC irradiation (Fig 2). Although the precise mechanisms of the effect of UV-activated PMS on fungal cell wall structures are yet to be elucidated, the difference in its efficiency between conidia and mycelia may be explained by the differential composition and organization of the cell walls. Liu et al. revealed that the outer layers of the cell wall structures of the conidia and mycelia of A. fumigatus differed in composition [36]. The major components of cell walls in both conidia and mycelia are a-(1,3)-glucan, b-(1,3)-glucan, and mannan [37]. However, mycelia contain galactoaminogalactans and glycosylated proteins that are absent in conidia during the resting stage [38]. Thus, the mycelial cell wall may be more rigid than the conidia, thereby resisting UVC and/or PMS treatment. In contrast, UVC treatment enabled the photoreactivation of fungi during the recovery process (Fig. 2). After UVC irradiation, the viability of fungal conidia, including A. niger, recovered over time [17]. However, PMS did not improve the photoreactivation or recovery of A. niger after UV treatment. This implied that the effect of PMS on the recovery rate of A. flavus was negligible. Therefore, the reduced viability of the mycelia may be primarily attributable to the effects of UVC. Nevertheless, the role of PMS should be further investigated through precise experiments using more diverse time courses during the recovery process.
The most remarkable finding of our study was that the amount of AFB1 in the mycelia increased markedly during the 24 h of recovery following UVC and/or PMS treatments (Fig. 3). Compared with the NT conditions, PMS (4 mM) facilitated the accumulation of significant levels of AFB1. As the exposure time to PMS (4 mM) was prolonged from 6 to 12 min, the accumulation of AFB1 further increased. UVC also marginally increased the AFB1 content but mitigated AFB1 accumulation with further increases in the UVC dose. Previous studies have suggested that UV irradiation either detoxifies AFs or inhibits their accumulation [2123]. In contrast, in our study, UVC treatment increased the accumulation of AFB1 during 24 h of recovery (Fig. 3b). This finding may be inconsistent with previous data. However, after closer examination of AFB1 production during treatment for 6 and 12 min, UV-treated mycelia exhibited slightly less AFB1 accumulation than mycelia under NT conditions (Fig. 3a). Thus, UVC treatment inhibits AFB1 production during the treatment. Considering that the negative effect of UVC on AF production was dose dependent (i.e., irradiation intensity and contact time), it is necessary to examine whether prolonged exposure to UVC further reduces AFB1 accumulation.
In general, the amount of AFB1 in the mycelia is modulated by degradation and/or de novo synthesis. To date, no precise data are available to elucidate these underlying mechanisms. Nevertheless, our results revealed that UVC and PMS play dual roles as stimuli and inhibitors of AFB1 biosynthesis, respectively. In our study, although high doses were required (1,200 mJ/cm2), UVC and UV-activated PMS degraded 70% of the pure standard of AFB1 in vitro (Fig. 5). These data directly indicated that UVC and PMS acted as degraders of AFB1. Previous results also suggested that UV irradiation was safe and a low-risk method to degrade aflatoxins [27, 39, 40]. Stanley et al. reported that UV-A reduced AFB1 by 70% at dose 1,200 mJ/cm2 through the photolysis and radical-mediated degradation [40]. Mechanistically, the double bond in the terminal furan ring, the most toxicological site of AFB1, was removed by UV irradiation. On the other hand, UVC and PMS act as exogenous stimuli that trigger the biosynthesis of AFB1. Although the detailed mechanism is yet to be elucidated, PMS generates reactive oxygen species (ROS) that usually causes oxidative stress at the cellular level. Various studies have reported that oxidative stress enhances AF biosynthesis as a cellular response to stress in fungi, including the Aspergillus species [41]. Additionally, exposure to UVC may act as another stress signal that triggers the biosynthesis of AFB1 during recovery. In our study, the responses of A. flavus to PMS and/or UVC were verified at the transcriptional level of the AF biosynthetic genes, especially by upregulating key regulatory genes, such as aflS and aflR, which are two main transcription factors located in the gene cluster responsible for AF biosynthesis. During 24 h of recovery following the treatments, the expressions of aflS and aflR were significantly upregulated under PMS treatment (Fig. 4). This implies that PMS enhances AFB1 biosynthesis in the mycelia. Although this effect of UVC was weaker than that of PMS, the former also induced the expression of aflS and aflR. Overall, the accumulation of AFB1 may be compromised by the positive upregulation of biosynthesis and negative degradation by UVC and/or PMS.
The contents or concentrations of AFs in various food sources are critical criteria for ensuring food safety in livestock, poultry, and humans. The FDA has set the action level of AFs in corn and other grains at 20 ppb. Although the limit varies depending on the type of AF and food source, the European Union has set the limit at 0.05 ppb. A recent risk assessment suggested changing the limit of AFs from 15 to 4 ppb in Chinese peanuts [42]. In our study, the actual level of change in AF concentration after PMS and/or UV treatment ranged from 0.04 to 0.1 ppb. Considering the current allowance limits, such increases in AFB1 levels should be regarded as a potential risk to human health. Therefore, based on our data, in practical applications, the dosage must be optimized for the inactivation efficiency of UVC and UVC-AOP to disinfect A. flavus. Although we achieved a high degree of inactivation (i.e., 3 log reduction) using UVC and/or PMS treatment, it is insufficient to ensure the safety of A. flavus contamination in the environment. Our results suggest that imperfect or intermediate doses of UVC and UVC-AOP facilitate AF biosynthesis. In the future, both the inactivation efficiency against A. flavus and effect on AF accumulation should be considered to develop sanitization methods to secure food safety.

5. Conclusions

The development or optimization of new fungal disinfection agents/methods is desirable to achieve efficiency, cost-effectiveness, and eco-friendliness. UVC and activated PMS radicals are versatile candidates that meet these standards. Nevertheless, imperfect or moderate disinfection can act as a stimulus or stressor that can increase mycotoxin biosynthesis. Based on our study, it should be appreciated that the accumulation of AFB1 was increased under the dosages of UVC and PMS efficiently but in completely inactivating A. flavus. Therefore, we speculate the higher doses of UVC and PMS used in the current study must be engaged to achieve the reasonable level of A. flavus disinfection and detoxify the aflatoxin simultaneously. In future investigations and practical applications of the disinfection of harmful microbes, the dosage should be cautiously determined and optimized to achieve a satisfactory effect on the accumulation of toxins and ensure disinfection efficacy.

Acknowledgement

This research was funded by the Cooperative Research Program for Agricultural Science and Technology Development (Project numbers RS-2023-00230820) and the Rural Development Administration, the Republic of Korea.

Notes

Conflict-of-Interest Statement

The authors declare that they have no conflicts of interest.

Author Contributions

S.D.J. (PhD student) suggested the research idea, conducted the research, and prepared manuscript. K.K. (research professor) designed the experimental procedures and prepared the manuscript. C.N.R. (postdoctoral fellow) conducted the research and prepared a partial draft. S.Y.S. (postdoctoral fellow) partially conducted the study. C. M. (professor) designed the research, provided funding, and supervised the study.

References

1. Amaike S, Keller NP. Aspergillus flavus. Annu. Rev. Phytopathol. 2011;49:107–133. https://doi.org/10.1146/annurev-phyto-072910-095221
crossref pmid

2. Klich MA. Aspergillus flavus: the major producer of aflatoxin. Mol. Plant Pathol. 2007;8:713–722. https://doi.org/10.1111/J.1364-3703.2007.00436.X
crossref pmid

3. Rushing BR, Selim MI. Aflatoxin B1: A review on metabolism, toxicity, occurrence in food, occupational exposure, and detoxification methods. Food Chem. Toxicol. 2019;124:81–100. https://doi.org/10.1016/j.fct.2018.11.047
crossref pmid

4. Caceres I, Khoury AA, Khoury RE, et al. Aflatoxin biosynthesis and genetic regulation: A review. Toxins. 2020;12:150. https://doi.org/10.3390/toxins12030150
crossref pmid pmc

5. Yu J, Chang PK, Ehrlich KC, et al. Clustered pathway genes in aflatoxin biosynthesis. Appl. Environ. Microbiol. 2004;70:1253–1262. https://doi.org/10.1128/AEM.70.3.1253-1262.2004
crossref pmid pmc

6. Bharose AA, Hajare ST, Narayanrao DR, et al. Whole genome sequencing and annotation of Aspergillus flavus JAM-JKB-B HA-GG20. Sci. Rep. 2024;14:18. https://doi.org/10.1038/s41598-023-50986-5
crossref pmid pmc

7. Trail F, Mahanti N, Linz J. Molecular biology of aflatoxin biosynthesis. Microbiology. 1995;141:755–765. https://doi.org/10.1099/13500872-141-4-755
crossref pmid

8. Green CF, Scarpino PV, Jensen P, Jensen NJ, Gibbs SG. Disinfection of selected Aspergillus spp. using ultraviolet germicidal irradiation. Can. J. Microbiol. 2004;50:221–224. https://doi.org/10.1139/W04-002
crossref pmid

9. Nourmoradi H, Nikaeen M, Stensvold CR, Mirhendi H. Ultraviolet irradiation: An effective inactivation method of Aspergillus spp. in water for the control of waterborne nosocomial aspergillosis. Water Res. 2012;46:5935–5940. http://dx.doi.org/10.1016/j.watres.2012.08.015
crossref pmid

10. Sun D, Mao J, Wei H, et al. Efficient prevention of Aspergillus flavus spores spread in air using plasmonic Ag-AgCl/α-Fe2O3 under visible light irradiation. ACS Appl. Mater. Interfaces. 2022;14:28021–28032. https://doi.org/10.1021/acsami.2c06963
crossref pmid

11. Wang Y, Yu M, Xie Y, et al. Mechanism of inactivation of Aspergillus flavus spores by dielectric barrier discharge plasma. Toxicon. 2024;239:107615. https://doi.org/10.1016/j.toxicon.2024.107615
crossref pmid

12. Yang D, Wei H, Yang X, et al. Efficient inhibition of Aspergillus flavus to reduce aflatoxin contamination on peanuts over Ag-loaded titanium dioxide. Toxins. 2023;15:216. https://doi.org/10.3390/toxins15030216
crossref pmid pmc

13. Al-Gabr HM, Zheng T, Xin Yu. Inactivation of Aspergillus flavus in drinking water after treatment with UV irradiation followed by chlorination. Sci Total Environ. 2013;463–464:525–529. https://doi.org/10.1016/j.scitotenv.2013.06.065
crossref pmid

14. Matte AS, Madrid IM, Santin R, Schuch LFD, Meireles MCA. In vitro activity of disinfectants against Aspergillus spp. Braz. J. Microbiol. 2013;44:481–484. https://doi.org/10.1590/S1517-83822013000200024
crossref pmid pmc

15. Peláeza AML, Catañod CAS, Yepesd EAQ, Villarroela RRG, Antonia GLD, Giannuzzi L. Inhibitory activity of lactic and acetic acid on Aspergillus flavus growth for food preservation. Food Control. 2012;24:177–183. https://doi.org/10.1016/j.foodcont.2011.09.024
crossref

16. Wen G, Xu X, Zhu H, Huang T, Ma J. Inactivation of four genera of dominant fungal spores in groundwater using UV and UV/PMS: Efficiency and mechanisms. Chem. Eng. J. 2017;328:619–628. https://doi.org/10.1016/j.cej.2017.07.055
crossref

17. Wen G, Zhao D, Xu X, Chen Z, Huang T, Ma J. 2019 Inactivation of fungi from four typical genera in groundwater using PMS/ Cl− system: Efficacy, kinetics and mechanisms. Chem. Eng. J. 2019;357:567–578. https://doi.org/10.1016/j.cej.2018.09.195
crossref

18. Zhou S, Yu Y, Zhang W, et al. Oxidation of microcystin-LR via activation of peroxymonosulfate using ascorbic acid: Kinetic modeling and toxicity assessment. Environ. Sci. Technol. 2018;52:4305–4312. https://doi.org/10.1021/acs.est.7b06560
crossref pmid

19. Wang P, Liu X, Qiu W, et al. Catalytic degradation of micropollutant by peroxymonosulfate activation through Fe(III)/ Fe(II) cycle confined in the nanoscale interlayer of Fe(III)-saturated montmorillonite. Water Res. 2020;182:116030. https://doi.org/10.1016/j.watres.2020.116030
crossref pmid

20. Zhang TY, Lu YS, Luo ZN, et al. 2022 Micropollutant removal and disinfection byproduct control by sequential peroxymonosulfate-UV treatment in water: A case study with sulfamethoxazole. J. Environ. Sci. 2022;117:141–150. https://doi.org/10.1016/j.jes.2022.03.046
crossref pmid

21. Faraji H, Yazdi FT, Razmi N. The influence of ultraviolet radiation on aflatoxin producing Aspergillus species’ isolated from Iranian rice. Toxicol. Rep. 2022;9:1528–1536. https://doi.org/10.1016/j.toxrep.2022.07.007
crossref pmid pmc

22. Ferreira CD, Lang GH, Lindemann IDS, et al. Postharvest UV-C irradiation for fungal control and reduction of mycotoxins in brown, black, and red rice during long-term storage. Food Chem. 2021;339:127810. https://doi.org/10.1016/j.foodchem.2020.127810
crossref pmid

23. Patras A, Julakanti S, Yannam S, Bansode RR, Burns M, Vergne MJ. Effect of UV irradiation on aflatoxin reduction: a cytotoxicity evaluation study using human hepatoma cell line. Mycotoxin Res. 2017;33:343–350. https://doi.org/10.1007/s12550-017-0291-0
crossref pmid

24. Mao J, He B, Zhang L, et al. A structure identification and toxicity assessment of the degradation products of aflatoxin B1 in peanut oil under UV irradiation. Toxins. 2016;8:332. https://doi.org/10.3390/toxins8110332
crossref pmid pmc

25. Freitas-Silva O, de Souza Coelho CC, Trombete FM, da Conceição RRP, Ribeiro-Santos R. Chemical Degradation of Aflatoxins. Hakeem KR, Oliveira CAF, Ismail A, editorsAflatoxins in Food. Springer; Cham: 2021. 233–258. https://doi.org/10.1007/978-3-030-85762-2_11
crossref pmid

26. Samarajeewa U, Sen AC, Cohen MD, Wei CI. Detoxification of aflatoxins in foods and feeds by physical and chemical methods. J. Food Prot. 1990;53:489–501. https://doi.org/10.4315/0362-028X-53.6.489
crossref pmid

27. Kutasi K, Recek N, Zaplotnik R, et al. Approaches to inactivating aflatoxins—a review and challenges. Int. J. Mol. Sci. 2021;22:13322. https://doi.org/10.3390/ijms222413322
crossref pmid pmc

28. Nahle S, Khoury AE, Assaf JC, et al. A promising innovative technique for mycotoxin detoxification from beverages using biofilms of lactic acid bacteria. Innov. Food Sci. Emerg. Technol. 2022;82:103165. https://doi.org/10.1016/j.ifset.2022.103165
crossref

29. Guo C, Fan L, Yang Q, Ning M, Zhang B, Ren X. Characterization and mechanism of simultaneous degradation of aflatoxin B1 and zearalenone by an edible fungus of Agrocybe cylindracea GC-Ac2. Front. Microbial. 2024;15:1292824. https://doi.org/10.3389/fmicb.2024.1292824
crossref pmid pmc

30. Cho M, Gandhi V, Hwang TM, Lee S, Kim JH. Investigating synergism during sequential inactivation of MS-2 phage and Bacillus subtilis spores with UV/H2O2 followed by free chlorine. Water Res. 2010;45:1063–1070. https://doi.org/10.1016/j.watres.2010.10.014
crossref pmid

31. Langvad F. A rapid and efficient method for growth measurement of filamentous fungi. J. Microbiol. Methods. 1999;37:97–100. https://doi.org/10.1016/S0167-7012(99)00053-6
crossref pmid

32. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔC T method. Methods. 2001;25:402–408. https://doi.org/10.1006/meth.2001.1262
crossref pmid

33. Yu J. Current understanding on aflatoxin biosynthesis and future perspective in reducing aflatoxin contamination. Toxins. 2012;4:1024–1057. https://doi.org/10.3390/toxins4111024
crossref pmid pmc

34. Fountain JC, Bajaj P, Nayak SN, et al. Responses of Aspergillus flavus to oxidative stress are related to fungal development regulator, antioxidant enzyme, and secondary metabolite biosynthetic gene expression. Front. Microbiol. 2016;7:2048. https://doi.org/10.3389/fmicb.2016.02048
crossref pmid pmc

35. Tian F, Lee SY, Woo SY, et al. Transcriptomic responses of Aspergillus flavus to temperature and oxidative stresses during aflatoxin production. Sci. Rep. 2021;11:2803. https://doi.org/10.1038/s41598-021-82488-7
crossref pmid pmc

36. Liu Z, Valsecchi I, Meur RAL, et al. Conidium Specific Polysaccharides in Aspergillus fumigatus. J. Fungi. 2023;9:155. https://doi.org/10.3390/jof9020155
crossref pmid pmc

37. Henry C, Fontaine T, Heddergott C, et al. Biosynthesis of cell wall mannan in the conidium and the mycelium of Aspergillus fumigatus. Cell. Microbiol. 2016;18:1881–1891. https://doi.org/10.1111/cmi.12665
crossref pmid

38. Gow NAR, Latge JP, Munro CA. The fungal cell wall: structure, biosynthesis, and function. Microbiol. Spectr. 2017. 5:FUNK-00352016. https://doi.org/10.1128/microbiolspec.funk-0035-2016
crossref pmid

39. Guo Y, Zhao L, Ma Q, Ji C. Novel strategies for degradation of aflatoxins in food and feed: A review. Food Res. Int. 2021;140:109878. https://doi.org/10.1016/j.foodres.2020.109878
crossref pmid

40. Stanley J, Patras A, Pendyala B, Vergne MJ, Bansode RR. Performance of a UV-A LED system for degradation of aflatoxins B1 and M1 in pure water: kinetics and cytotoxicity study. Sci. Rep. 2020;10:13473. https://doi.org/10.1038/s41598-020-70370-x
crossref pmid pmc

41. Roze LV, Hong SY, Linz JE. Aflatoxin biosynthesis: current frontiers. Annu. Rev. Food Sci. Technol. 2013;4:293–311. https://doi.org/10.1146/annurev-food-083012-123702
crossref pmid

42. Lien KW, Wang X, Pan MH, Ling MP. Assessing aflatoxin exposure risk from peanuts and peanut products imported to Taiwan. Toxins. 2019;11:80. https://doi.org/10.3390/tox-ins11020080
crossref pmid pmc

Fig. 1
The inactivation of the conidia of A. flavus by treatment with PMS and/or UVC. (a) The effect of individual treatment of PMS or UVC on the inactivation of conidia. (b) The combined effect of PMS and UVC on the inactivation of conidia.
/upload/thumbnails/eer-2023-565f1.gif
Fig. 2
The recovery of mycelial growth of A. flavus after exposure to UVC and/or PMS at different time courses or dosages. The diameter of the mycelia on the PDA medium was measured after 24 h of recovery following UVC and/or PMS treatment. Data are the mean ± SD of three replicates. *Different alphabets indicate significantly different values at the 95% confidence level. a–e: Differences among time courses or dosages across all treatments; x–y: differences among treatment agents within the same dosage (p-value <0.05).
/upload/thumbnails/eer-2023-565f2.gif
Fig. 3
The accumulation level of AFB1 in mycelia treated with PMS and/or UVC. (a) The comparison between the concentrations of AFB1 in mycelia at 0 and 24 h after treatment. (b) The arithmetic difference between concentrations after 24 and 0 h of treatment. Data are indicated as the mean ± SE (n=3). Statistical significances of data were determined by Student t-tests (p-value; *p<0.05, **p<0.001).
/upload/thumbnails/eer-2023-565f3.gif
Fig. 4
Expression levels of genes in mycelia treated with PMS and/or UVC. The Ct values for each condition were normalized to 0 h under non-treated (NT) conditions. Data are indicated as the mean ± SE (n=3). Statistical significance of the data was determined using Student’s t-test (p-value; *p<0.05, **p<0.001).
/upload/thumbnails/eer-2023-565f4.gif
Fig. 5
In vitro degradation of AFB1 under treatment with PMS and/or UVC. (a) The effect of treatment with PMS from 0 to 40 min. (b) The effect of various dosages of UVC alone and combined treatment of UVC and PMS on AFB1.
/upload/thumbnails/eer-2023-565f5.gif
Table 1
Primer sequences for RT-qPCR
Genes Primer sequence (5′-3′) Position Size (bp)
β-tublin Forward: GGTTCCTTTCCCTCGTCTTC 1,182,106a 146
Reverse: GGAAGTCAGAAGCAGCCATC 1,181,961a
aflD Forward: CCGAGGTACGGTCTATCGAA 2,238,172a 190
Reverse: ATGATCATCCGACTGCCTTC 2,237,983a
aflS Forward: TGGTGCGACCGTTATTTACA 2,220,538a 94
Reverse: GGTTGGGTCAGCAACTGTTT 2,220,445a
aflR Forward: TCGTCCTTATCGTTCTCAAGG 1,646b 110
Reverse: ACTGTTGCTACAGCTGCCACT 1,755b

Positions are in accordance with the published sequence of the β-tubulin, aflD, and aflS genes of Aspergillus flavus (GeneBank accession no. NW_002477243.1)

Positions are in accordance with the published sequence of the aflR gene of Aspergillus flavus (GenBank accession No. AF441435.2)

TOOLS
PDF Links  PDF Links
PubReader  PubReader
Full text via DOI  Full text via DOI
Download Citation  Download Citation
  Print
Share:      
METRICS
0
Crossref
0
Scopus
1,125
View
23
Download
Editorial Office
464 Cheongpa-ro, #726, Jung-gu, Seoul 04510, Republic of Korea
FAX : +82-2-383-9654   E-mail : eer@kosenv.or.kr

Copyright© Korean Society of Environmental Engineers.        Developed in M2PI
About |  Browse Articles |  Current Issue |  For Authors and Reviewers